Skip to main content

Table 1 Real-time PCR primers and probe for dengue virus cDNA identification*

From: A local outbreak of dengue caused by an imported case in Dongguan China

Primers/probe Sequence (5'-3') Working concentration Length of amplified fragment (bp) Type specificity
Den-FP GCATATTGACGCTGGGAGAGA 0.5 μM 68 Universal for all four types
Den-RP GGCGTTCTGTGCCTGGAAT 0.5 μM   
Den-probe FAMCAGAGATCCTGCTGTCTCMGB 0.25 μM   
Real-time PCR program Pre-denature at 95°C for 45 s, denature at 95°C for 20 s, annealing at 65°C for 20 s, elongation at 72°C for 30 s, 40 cycles, elongation at 72°C for 1 min, keep at 4°C
  1. *From diagnostic criteria for Dengue Fever (DF) (WS216-2008) enacted by the Ministry of Health of People's Republic of China.
\